Ramos Et Al Microbiology and Molecular Biology Reviews June 2005 P 326356

• Periodical List
• Scientific Reports
• PMC5931544

Genomic analysis and immune response in a murine mastitis model of vB_EcoM-UFV13, a potential biocontrol agent for use in dairy cows

Vinícius da Silva Duarte,^ane Roberto Sousa Dias,¹ Andrew M. Kropinski,^two Stefano Campanaro,³ Laura Treu,^{3, 4} Carolina Siqueira,^five Marcella Silva Vieira,^five Isabela da Silva Paes,⁵ Gabriele Rocha Santana,⁵ Franciele Martins,⁵ Josicelli Souza Crispim,¹ André da Silva Xavier,^six Camila Geovana Ferro,⁷ Pedro Grand. P. Vidigal,⁸ Cynthia Canêdo da Silva,ⁱ and Sérgio Oliveira de Paula ⁵

Vinícius da Silva Duarte

^oneDepartment of Microbiology, Federal University of Viçosa, Av. Peter Henry Rolfs, southward/north, Campus Universitário, 36570-900 Viçosa, Minas Gerais Brazil

Roberto Sousa Dias

¹Department of Microbiology, Federal Academy of Viçosa, Av. Peter Henry Rolfs, southward/northward, Campus Universitário, 36570-900 Viçosa, Minas Gerais Brazil

Andrew K. Kropinski

^twoDepartments of Food Science, and Pathobiology, University of Guelph, Guelph, Ontario, N1G 2W1 Canada

Stefano Campanaro

³Department of Biology, University of Padova, Padova, Italy

Laura Treu

³Department of Biology, Academy of Padova, Padova, Italy

⁴Department of Environmental Applied science, Technical University of Denmark, Miljoevej, Edifice 115, DK-2800 Kgs, Lyngby, Kingdom of denmark

Carolina Siqueira

^fiveDepartment of General Biology, Federal University of Viçosa, Av. Peter Henry Rolfs, s/northward, Campus Universitário, 36570-900 Viçosa, Minas Gerais Brazil

Marcella Silva Vieira

^vDepartment of General Biology, Federal University of Viçosa, Av. Peter Henry Rolfs, s/n, Campus Universitário, 36570-900 Viçosa, Minas Gerais Brazil

Isabela da Silva Paes

⁵Department of General Biology, Federal University of Viçosa, Av. Peter Henry Rolfs, s/northward, Campus Universitário, 36570-900 Viçosa, Minas Gerais Brazil

Gabriele Rocha Santana

⁵Section of General Biology, Federal University of Viçosa, Av. Peter Henry Rolfs, due south/n, Campus Universitário, 36570-900 Viçosa, Minas Gerais Brazil

Franciele Martins

⁵Department of General Biology, Federal University of Viçosa, Av. Peter Henry Rolfs, s/n, Campus Universitário, 36570-900 Viçosa, Minas Gerais Brazil

Josicelli Souza Crispim

^aneSection of Microbiology, Federal University of Viçosa, Av. Peter Henry Rolfs, due south/n, Campus Universitário, 36570-900 Viçosa, Minas Gerais Brazil

André da Silva Xavier

⁶Embrapa Maize and Sorghum, Rodovia MG 424, Sete Lagoas, Minas Gerais Brazil

Camila Geovana Ferro

^viiDepartment of Found Patology, Federal University of Viçosa, Av. Peter Henry Rolfs, southward/n, Campus Universitário, 36570-900 Viçosa, Minas Gerais Brazil

Pedro M. P. Vidigal

^viiiNúcleo de Análise de Biomoléculas (NuBioMol), Center of Biological Sciences, Federal Academy of Viçosa, Viçosa, Minas Gerais Brazil

Cynthia Canêdo da Silva

¹Department of Microbiology, Federal University of Viçosa, Av. Peter Henry Rolfs, s/n, Campus Universitário, 36570-900 Viçosa, Minas Gerais Brazil

Sérgio Oliveira de Paula

⁵Department of General Biology, Federal University of Viçosa, Av. Peter Henry Rolfs, south/due north, Campus Universitário, 36570-900 Viçosa, Minas Gerais Brazil

Received 2018 January 2; Accepted 2018 April eleven.

Abstruse

Bovine mastitis remains the principal crusade of economic losses for dairy farmers. Mammary pathogenic Escherichia coli (MPEC) is related to an acute mastitis and its handling is still based on the use of antibiotics. In the era of antimicrobial resistance (AMR), bacterial viruses (bacteriophages) present as an efficient treatment or prophylactic option. Yet, this makes it essential that its genetic construction, stability and interaction with the host immune organization exist thoroughly characterized. The present report analyzed a novel, broad host-range anti-mastitis agent, the T4virus vB_EcoM-UFV13 in genomic terms, and its activeness confronting a MPEC strain in an experimental Due east. coli-induced mastitis mouse model. 4,975 Single Nucleotide Polymorphisms (SNPs) were assigned between vB_EcoM-UFV13 and Eastward. coli phage T4 genomes with high bear upon on coding sequences (CDS) (37.lx%) for virion proteins. Phylogenetic copse and genome analysis supported a recent infection mix between vB_EcoM-UFV13 and Shigella phage Shfl2. After a viral stability evaluation (e.grand pH and temperature), intramammary administration (MOI 10) resulted in a x-fold reduction in bacterial load. Furthermore, pro-inflammatory cytokines, such as IL-half dozen and TNF-α, were observed after viral handling. This piece of work brings the whole characterization and allowed response to vB_EcoM-UFV13, a biocontrol candidate for bovine mastitis.

Introduction

Bovine mastitis remains the master crusade of economic losses for dairy farmers, estimated at $ (U.s.)533 billion worldwide, also as public health concerns, since low quality milk can be considered a vehicle for pathogen transmission ^ane–3 .

Mastitis treatment is typically based on the utilise of short and long-acting antibiotics, respectively, during the lactation and dry period ^four . In terms of the lactation flow and specifically regarding clinical mastitis, Escherichia coli, Streptococcus uberis, Streptococcus dysgalactiae and Staphylococcus aureus are the principal etiological agents involved that have been routinely isolated ⁵ . Amidst these pathogens, mammary pathogenic Escherichia coli (MPEC) is responsible for an astute mastitis characterized by inflammation, increased somatic cell count (SCC) and impaired milk quality fifty-fifty after the infection has been cured ⁶ .

Using Eastward. coli strains obtained from different types of mastitis (e.chiliad per-acute and persistent) and the non-pathogenic strain K71, Blum et al. (2017) performed a mammary immune response comparison in experimentally infected cows and noticed differences regarding TNF-α, IL-vi and IL-17 secretion levels for each MPEC.

Within the current scenario of widespread antibiotic-resistant leaner, bacterial viruses present as an efficient therapeutic or prophylactic tool in guild to control different pathogens in dairy cows at dissimilar lactation stages. This is supported by electric current in vitro and in vivo assays ^7–13 .

Considered a model system in molecular biological science, coliphage T4 has been studied since the 1940s and possesses about 300 genes organized in a 168.9 kb linear dsDNA with an average GC content of 34.v% ¹⁴ . Lytic viruses related to T4 accept awoken interest for their application in phage therapy due the absence of lysogenic modules, a wide-host-range (from Proteobacteria to Blue-green alga phyla) and, recently, the identification of virion-associated peptidoglycan hydrolases (VAPGHs), which are considered potential enzybiotics ^15–17 .

Indeed, T4 was used by Bruttin ¹⁸ in the first safety examination of phage therapy in humans and in immunological assays in social club to elucidate the interactions between viruses, its host and the immune system. Bocian et al. ¹⁹ investigated how purified T4 phage and T4-generated E. coli lysate impact immune cells differentiation, highlighting that lysis of Gram-negative leaner by phages might not trigger excessive monocyte induction.

Currently, several studies have been exploited the use of mouse models in the try to evaluate novels anti-mastitis drugs mainly against E. coli and Southward. aureus ^20–26 . The use of animal models is time and cost effective approach, forth with a previous step for pre-clinical and clinical assays ²⁷ . However, the absenteeism of intrinsic moo-cow factors can be considered a bottleneck when data is analyzed ²⁸ .

The aims of the present study were to characterize the Escherichia phage UFV13, a T4virus, in genomic, protein and physiological terms and evaluate the immune response in an experimental E. coli-induced mastitis mouse model with the aim to use it in clinical trials to command mastitis in dairy cows.

Materials and Methods

vB_EcoM-UFV13 isolation and purification

vB_EcoM-UFV13 (UFV13) was obtained from the sewerage organization of Viçosa, Minas Gerais state, Brazil and was propagated on Escherichia coli 30 following the well-established Sambrook & Russell ²⁹ protocol. This virus belongs to the bacterial virus collection of the Laboratório de Imunovirologia Molecular (LIMV) at Universidade Federal de Viçosa (UFV), Viçosa metropolis, Brazil.

After virus propagation, viral particles were purified past a three-step protocol using ion exchange and desalting columns in a chromatography organisation (ÄKTAprime plus, GE Healthcare Life Sciences, Uppsala, Sweden). Briefly, an initial step using HiTrap Desalting prepacked column (GE Healthcare Life Sciences, Uppsala, Sweden) was conducted to remove whatever salts used at virus propagation stages and the outset two peaks were collected and purified using an ion exchange chromatography cavalcade, with specific fractions (vii to 11) driven to the final stride, a new desalting process. For the anion substitution column, start (xx mM Tris-HC, pH 8.0) and elution buffers (20 mM Tris-HC, 1 K NaCl, pH viii.0) were used, whereas in desalting steps a phosphate buffer (20 mM sodium phosphate, 0.xv Yard NaCl, pH 7.0) was prepared. Flow rate of 5 mL.min⁻¹ was adopted for both columns. Finally, viral titer was measured at 37 °C past double-agar overlay method ³⁰ using Eastward. coli xxx as the plating host. Phage stocks were stored at 4 °C for further analysis.

Bioinformatic analysis

Phage genome extraction, sequencing and annotation methodologies are described according to Duarte et al. ³¹ . Hypothetical proteins were manually checked for homologs using UNIPROT database. Protein isoelectric point and molecular weight were obtained using ExPASy ³² . Putative tRNAs and Rho-contained transcription terminators were, respectively, predicted using tRNAscan-SE ³³ and ARNnold spider web tool ³⁴ . The Database of Gene Regulation in Bacteriophages (phiSITE) ³⁵ was used in gild to cheque the three major classes of promoters (early, middle and late) as well as to confirm putative Rho-independent terminators. The CGView Server was used to generate a UFV13 genome graphical map ³⁶ .

Nucleotide differences between UFV13 and Enterobacteria phage T4 (accretion number {"blazon":"entrez-nucleotide","attrs":{"text":"AF158101.six","term_id":"29345244","term_text":"AF158101.6"}}AF158101.6) genomes were performed past checking reading alignments. Loftier-quality Illumina reads were filtered and adaptor sequences were removed using Trimmomatic software (ver 0.33) ³⁷ (parameters: LEADING:x TRAILING:10 SLIDINGWINDOW:four:15 MINLEN:65) and aligned to Enterobacteria phage T4 using Bowtie2 software (v2.2.four) ³⁸ . SAMtools ³⁹ was used to catechumen the output SAM format to BAM format and, subsequently, to sort the BAM file. The sorted BAM file was processed with mpileup tool (SAMtools package) in order to extract the variants. The Binary Phone call Format (BCF) created was converted to VCF format using BCFtools ³⁹ . VCF file and Enterobacteria phage T4 genes were used as input for SnpEff program ⁴⁰ . Only variants with predicted "loftier" or "moderate" affect on the protein-coding gene were analyzed.

Whole-genomes that represent each genus from the subfamily Tevenvirinae (T4virus, Cc31virus, S16virus, Js98virus and Sp18virus) deposited on the International Committee on Taxonomy of Viruses (ICTV) were downloaded from NCBI (accretion numbers are provided in Supplementary Table^four) and aligned with UFV13 genome using Progressive MAUVE ⁴¹ . Whole-genome unmarried nucleotide polymorphisms (SNPs) were extracted as described in Treu et al. ⁴² and a SNP-based phylogenetic tree was constructed using PHYLIP parcel ⁴³ and visualized past dendroscope ⁴⁴ . Furthermore, a whole-genome phylogenetic tree was formulated aligning previously cited genomes from the Tevenvirinae subfamily. Online tools ClustalW2 ⁴⁵ and MAFTTT version vii ⁴⁶ were used for multiple alignment. A neighbour-joining tree was drafted with MEGA7 ⁴⁷ and visualized with FigTree (http://tree.bio.ed.air conditioning.u.k./software/figtree/).

In silico bacterial hosts of UFV13 were predicted using HostPhinder ⁴⁸ .

vB_EcoM-UFV13 structural protein analysis

With the aim of obtaining the UFV13 structural poly peptide profile, proteomic analysis was conducted.

Viral propagation/purification (see item 2.2) were conducted and phage particles concentrated past adding NaCl 1 M and polyethylene glycol 8000 (PEG8000) 10% (w/v). The mixture was kept overnight at 4 °C. After a centrifugation (10,000 × g, fifteen min), viral pellet was resuspended in one mL of SM buffer and one volume of chloroform followed by centrifugation at four,000chiliad for x min. An equal volume of trichloroacetic acrid (TCA) 10% (v/v) was added to the supernatant and incubated on ice for thirty min. The precipitated viral proteins were nerveless past centrifugation (11,000 × g, xx min), washed 3 times with acetone (11,000 × yard, 10 min) and resuspended in water. The BCA Poly peptide Analysis Kit (Boster Biological Applied science, Wuhan, China) was used to gauge poly peptide concentrations.

For protein profiling, the viral proteins were separated via sodium dodecyl sulfate-polyacrilamide electrophoresis (SDS-PAGE) on a15% gel ⁴⁹ . Protein bands were highlighted by Coomassie Brilliant Blue R-250 dye and removed as described by Shevchenko et al. ⁵⁰ . Mass spectrum (MS) was caused past matrix-assisted laser desorption-ionization time of flight (MALDI/TOF-TOF) (Ultraflex Three - BRUKER DALTONICS). Spectra intervals between 500 and iii,500 kDa were selected and forwarded for MS/MS analysis. Results were obtained by Mascot™ (Matriz Science) software using the NCBl nr protein database. Only proteins and peptides indicated as significant by Mascot were considered for farther analysis.

Physiological features

Physiological features were assessed in triplicate following the protocols described by Jurczak-Kurek et al. ⁵¹ . In each of the post-obit cases, post-obit treatment the phage preparation was diluted and tittered as described above (two.two).

pH stability

Viral capability at unlike acidic and alkaline pH values was evaluated. One mL of purified viruses were transferred to ix mL LB medium with pH 2, pH 4, pH seven (control), pH 10 and pH 12 at a 1:9 ratio and incubated for i h at 37 °C, being proceeded by a 10-fold series dilution and plating every bit described in item ii.2. After overnight incubation at 37 °C, virus stability was adamant past the percentage of viruses able to produce lysis plate.

Thermal stability

Thermal stability studies on LB-diluted phage suspensions were made at −20 °C, 40 °C, 62 °C and 95 °C, respectively, for 12 h, 40 min, 40 min and 5 min. Later on these periods, a serial 10-fold dilution was conducted and a specific aliquot was plated and incubated overnight at 37 °C. Viruses that did not undergo any thermal treatment were used as a control.

Viral ability to propagate in different temperatures

Viral replication at different temperatures (iv °C, 22 °C, 30 °C and 37 °C) was assessed by spot-assay after 24 hours of incubation using a ten-fold serially diluted viral stock in LB medium.

Osmotic stupor issue

In order to verify the effect of the osmotic shock on virus particles, a stock aliquot was transferred to TM buffer (10 mM Tris–HCl, 10 mM MgSO₄; pH 7.2) with sodium chloride 4.5 1000, incubated at room temperature for 15 min and quickly diluted in TM buffer without sodium chloride. Bacterial viruses incubated in TM buffer without sodium chloride were used every bit a control.

Antiviral resistance

Antiviral activity of sodium dodecyl sulfate (SDS), sodium lauroyl sarcosinate (Sarkosyl) and cetyltrimethylammonium bromide (CTAB) on virus particles was adamant incubating a standardized viral break with 0.09% SDS (20 min at 45 °C), 0.1% CTB (1 min at 22 °C) and 0.1% Sarkosyl (ten min at 22 °C). Controls were done considering the same conditions for each antiviral chemical compound but they were substituted for TM buffer.

Organic solvent effect

To written report the effect of four unlike organic solvents, a viral pause was added to 63% ethanol, xc% acetone, xc% chloroform and l% dimethyl sulfoxide (DMSO). Mixtures were incubated for 1 h at 22 °C (ethanol and acetone), 1.5 h at 4 °C (chloroform) and ten min at 4 °C (DMSO). In the next stride, ten-fold dilutions in TM buffer (ten mM Tris–HCl, x mM MgSO₄; pH 7.ii) were prepared and used for plating. Phages incubated in TM buffer under weather described above, were used as a control.

Animal model and immune response

Escherichia coli 30 strain

The mammary-pathogenic E. coli 30 was isolated from a dairy cow with acute mastitis and kindly provided by Brazilian Agricultural Research Corporation (Empresa Brasileira de Pesquisa Agropecuária – EMBRAPA) Dairy Cattle (Juiz de Fora, Minas Gerais, Brazil). E. coli 30 was evaluated for its ability to course biofilm as well as for movement capacity. Motility assays were conducted according to Deziel et al. ⁵² . Briefly, an overnight E. coli 30 aliquot was washed, suspended in distilled and sterilized h2o, and inoculated in King B medium (peptone 20 thousand/Fifty, MgSO_four.7H₂O 1.v m/L, K₂HPO₄ 1.five g/L), supplemented with one.5, 0.five and 0.3% of agar for twitching, swarming and swimming tests, respectively. Biofilm analysis followed the mutual crystal violet (CV) staining method ⁵³ . Later incubation (37 °C for 48 h), wells were washed 3 times with PBS buffer to remove not adherent cells. CV was added at a minimum volume capable overcome bacterial suspension book, making possible quantify all bacterial biomass, and incubated for 30 minutes at room temperature. To biomass quantify, CV was removed, wells done with PBS, added ethanol to solubilize biomass internal CV crystals, and optical density measured at 560 nm. All assays were performed in triplicate.

Antimicrobial susceptibility test of Eastward. coli 30 was assessed by disc diffusion analysis using polisensidiscs for 25 different antibiotics (DME, Araçatuba, São Paulo, Brazil) following the manufacture's recommendation. The results were interpreted according to the standards of the Clinical and Laboratory Standards Establish (CLSI) ⁵⁴ .

E. coli-induced mastitis in mouse

With the aim to evaluate UFV13 effectiveness and the immune response against E. coli 30 in vivo, an experimental East. coli-induced mastitis mouse model was used. The trial followed the methodology described by Chandler ⁵⁵ , with some modifications, and was approved by the Ethics Committee (Comissão de ética no uso de animais/UFV) co-ordinate to the protocol 64/2016. Lactating Balb/c female mice (5 to 15 days) was intraperitoneally anesthetized with 10% Ketamine and 2% Xylazine, with subsequent surgical operation of the mammary gland by cutting the teat canal of the last two abdominal ceilings (R5 and L5 of each animal were used) (Supplementary Figure⁴). Due east. coli 30 (100 UFC/ml), PBS and phage served as the control groups, while phage plus bacteria was considered the handling group (MOI x). Viral addition was done iv hours later on bacterial inoculation. Three animals were used to perform each experimental group.

In society to assess the lytic activity of the phage vB_EcoM-UFV13 in mammary glands, animals were euthanized 48 hours after the handling by coldhearted overdose. Infected mammary glands were removed and transferred to i.5 ml of (PBS), macerated and serially diluted (one:10) in PBS buffer. A microdrop assay ⁵⁶ was performed to estimate Eastward. coli 30 colony-forming unit (CFU).

Cytokines IL-half dozen, TNF-α, IL-2, IFN-γ, IL-four, IL-ten and IL-17A obtained from macerated mammary gland (L5 and R5 from each animate being was pooled) were simultaneously quantified by the Cytometric Dewdrop Array kit (CBA, BD Bioscience) in a BD FACSVerse Menses cytometry following manufacturer'south recommendations.

Histological analysis

For histology, mice were euthanized 48 hours after phage treatment. The mammary glands were removed and stock-still in Karnovsky fixative (paraformaldehyde 4% and glutaraldehyde 4%, pH 7.3). Further, the tissues were embedded in paraffin and a 5 µm section was obtained by microtomy, stained with hematoxylin and eosin (H & Eastward) and observed under calorie-free microscopy. The images were caused under an Olympus DP73 microscope.

Statistical assay

Statistical assay was performed with GraphPad Instat 3 software (GraphPad, La Jolla, CA, USA) using the ane-manner assay of variance (ANOVA) at 95% accuracy level to evaluate the differences between mammary gland cytokine production under different conditions. This assay was set in triplicate and, for each animal, the two intestinal ceilings were pooled into 1 sample. Tukey's exam was used as post hoc test.

Results and Discussion

vB_EcoM-UFV13 genome analysis

Bacteriophage UFV13 was isolated from samples obtained in the sewage organisation of Viçosa, Minas Gerais, Brazil, a well-known source of novel viruses ⁵⁷ .

From the genome sequence (165,772 bp, GC content 34.8%), 269 ORFs were predicted and annotated. The size is similar to that of other members of the T4virus genus ⁵⁸ . In addition, a total of x tRNA encoding genes (Gln, Leu, Gly, Pro, Ser, Thr, Met, Tyr, Asn and Arg) were identified and are organized in a factor cluster without introns or pseudogenes (Fig.1). 13 ORFs showed an identity below 70% with the reference phage T4, while 24 ORFs were annotated as hypothetical protein coding sequences. ORFs 50 and 232 are, respectively, coding sequences for T2 and T6 bacteriophage proteins. 13 ORFs encode for Shigella phage proteins (pSs-ane, Shfl2, Shf125875, SH7, SHBML-fifty-1). Genes for IpII and IpX were not identified in the UFV13 phage genome. Cistron and poly peptide data such as genomic coordinates, poly peptide weight, pI and putative function for each UFV13 ORF are reported in Supplementary Table^ane.

Genome map of vB_EcoM-UFV13. The linear genome was circularized in society to meliorate its visualization. CDS, ORF, GC content, GC skew+ and GC skew- are reported in circles from outside inward.

Functional categorization of UFV13 genes (Supplementary Table²) revealed that nonessential and auxiliary genes mainly related to homing endonucleases of introns such as I-TevI, I-TevII and I-TevIII are absent-minded, as with some of their related introns like mob and seg genes (Table1). Homing endonucleases of introns are considered systems associated with factor conversion events, transference of mobile elements and cistron exclusion in mixed infections ¹⁴ . In fact, genome analysis suggests a recent mixed infection among UFV13 and Shigella phage Shfl2, once segF was substituted by soc.1 and soc.2 from Shigella phage Shfl2. According to Belle et al. ⁵⁸ , segF was absent in T2 phages, but the region is occupied past soc.1 and soc.2.

Table-1

Gene	Function	Relevance
mobA	Pseudogene of Mob site-specific Dna endonuclease	Nonessential
mobB	Putative site-specific intron-like Dna endonuclease	Nonessential
mobC	Putative intron-like Deoxyribonucleic acid endonuclease	Auxiliary
mobD	Putative site-specific Deoxyribonucleic acid endonuclease	Nonessential
mobE	Putative mobile endonuclease	Nonessential
segA	Site-specific intron-like DNA endonuclease	Nonessential
segB	Probable site-specific intron-like DNA endonuclease	Nonessential
segC	Site-specific intron-like Deoxyribonucleic acid endonuclease	Nonessential
segD	Probable site-specific intron-like Dna endonuclease	Nonessential
segE	Probable site-specific intron-similar Deoxyribonucleic acid endonuclease	Nonessential
segF	Intron-like endonuclease. A probable fusion protein, generated from 56 and 69 by hopping of ribosomes across a pseudoknot, is larger	Nonessential
repEA	Protein auxiliary for initiation from oriE	Auxiliary
repEB	Poly peptide required for initiation from oriE	Auxiliary
I-TevI	Intron-homing endonuclease	Nonessential
I-TevII	Endonuclease for nrdD-intron homing	Nonessential
I-TevIII	Lacking intron homing endonuclease	Nonessential
rnaD	Stable RNA	Auxiliary
stp	Peptide modulating host restriction system	Auxiliary
nrdA	Ribonucleotide reductase α subunit	Auxiliary; nrd-defective hosts

Function and relevance were integrally withdrawn from Miller et al. (2003).

Similarity analysis using the deposited genomes from Yersinia phage PST and Shigella phage Shfl2 showed that the bacteriophage UFV13 has 97% identity with both phages. However, it has a larger percentage of aligned genome (96%) for the Shfl2, and ninety% of genome aligned to phage PST (Supplementary Figure^one). Comeau et al.⁵⁹, characterized Yersinia phage PST genome, containing dsDNA with 167,785 bp, 35.3% GC content and 9 tRNAs, whose values are near to those found for the phage UFV13, with 34.8% GC content. Jun et al., (2016) identified 10 tRNAs for both pSs-i and Shfl2 viruses infecting Shigella spp. as host. Despite little existing cognition about tRNAs functioning in phage life cycles, high tRNAs numbers found in some bacteriophages could be proportional to phage genomes sizes and are related to a curt latent menstruum and high burst size value ^sixty .

In the full, 35, 21 and 31, early, centre and late promoter regions respectively, were predicted, which corresponds to 73% of the promoters identified for the T4 genome (Supplementary Table³). As expected, no promoter regions for mob and seg genes were found, along with I-TevII and internal protein II (ipII).

Overall, termination of transcription in T4 bacteriophages occurs past an intrinsic termination signal, a stem-loop organization accompanied by a U-rich region, or a Rho-dependent termination mechanism ⁶¹ . For UFV13, 82 Rho-independent transcription terminators were predicted and compared against phiSITE database. 30 sequences displayed high identity with the reference phage, while five were not predicted but were found using the sequences available on the phiSITE. Terminators for the genes 45, v.4/6′, 34/35, 35, 37, nrdA, uvsY.−2 and 56/segF were not found or fifty-fifty identified using phiSITE (Tabular array2), while for the genes such as regA, wac, 24(b) and thirty.ix(b) were, respectively, detected on the ORFs 52, 163, 178 and 208. According to Miller et al. (2003), generally 34 terminators are establish in the T4 genome. The absence of terminators for the genes nrdA and 56/segF can be explained by their absenteeism, since these genes were not annotated. The significance of terminators within genes is unknown but have been described for T4 phages ¹⁴ .

Table-2

Primary features of the predicted Rho-contained transcription terminators.

Intergenic location	Genome position	Strand	Predicted Rho-independent transcription terminator site	Free energy (kcal/mol)
39.1	4310..4341	Minus	TTTAAATAAAAGGCCTTCGGGCCTTTAGCTTTATG	−ten.60
soc	15135..15168	Minus	AATTCAAGGACTCCTTCGGGAGTCCTTTTTCATT	−16.30
uvsX-twoscore	21337..21371	*	*	*
Unknown gene	25445..25477	Minus	TAAATCTAGGGACCTCCGGGTCCCTTTTTCACAC	−12.10
regA	28228..28259	*	*	*
α-gt	35109..35140	Minus	ACAAAATAAAGGGCTTCGGCCCTTTAGCTTTATA	−10.sixty
α-gt.2	36378..36411	Minus	TATGCGGATAGGAGCTTCGGCTCCTATATTGCTT	−14.twenty
55.3	38744..38775	Minus	GTTTAGCTAAGGGCTTCGGCCCTTTTTGGATAAT	−10.sixty
nrdH	39707..39739	Minus	GATTAAGACGGGCCCTCTGGGCCTTTCTTTCTCG	−viii.fourscore
Pin	43124..43166	Minus	AAATACCCTTATCTATTTAAGGTAAGGGTTTATTA	−ten.70
nrdC.11	51781..51818	Minus	AATGATAGGGAGCCTTCGGGCTCCCTTTTTTATT	−18.40
rI.−1	55358..55389	Minus	TAACATTAGTCTCCTTCGGGAGACTTTTTTCATT	−thirteen.fifty
Vs	58098..58128	Minus	TATATCAAGGGCGATATTGTCGCCCTTTTTCTTTA	−11.xl
e.6	66465..66498	Minus	ATAATGATAAGGGGCTTCGGCCCCTATTACTTGG	−13.xc
RNA C	69462..69503	Minus	GCTTAGCCCCAGCCGAAAGGTTGGGGCTTTTTA	−17.40
eight	84691..84728	Plus	TAAATTAAGGGAGCCCATGGGCTCCCTTTTTCTT	−16.50
wac	91126..91161	*	*	*
19	98662..98695	Minus	AAGCAGGATGGGGATTTCTCCCCATTCaTTTTAT	−14.50
23	151432..151461	Plus	AATTGAGGGAGCCTTCGGGTTCCCTTTTTCTTTA	−sixteen.70
24(a)	105412..105447	Plus	AAAACAAAGGGACCTTTCGGTCCCTTTTTATTTA	−12.30
24(b)	105467..105499	*	*	*
hoc	106999..107032	Minus	TAATCATAAGGGGCTTCGGCCCCTTTCTTCATTT	−14.50
54	118931..118972	Plus	CTAACAATGGGGACCGAAAGGTCCCCATATTTTT	−19.90
alt.one	123501..123532	Minus	GATTACTAAAGGCCTTCGGGCCTTTAaTTTTATAA	−14.eighty
xxx.ix(a)	128117..128154	Minus	AAGTTGAGGACTCCTTCGGGAGTCCTTTTTTATT	−16.30
xxx.nine(b)	128162..128198	*	*	*
nrdB	135904..135939	Minus	TTAAGGAGTGGGCCGCAAGGCCCATTTTATTATG	−fifteen.30
32	143116..143152	Minus	ATTAATTGGGGACCTCTAGGGTCCCCTTTTTTAT	−xiv.90
T	157574..157618	Plus	CAAACCCTCGTTGAATTCGTCGATGAGGGTTTTC	−11.10
motA.1	160357..160396	Minus	ATTTTAGGGAGAGCTTCGGCTCTCCCTTTTTTAT	−xix.60
Ac	161968..162004	Minus	TGCCCTTGCTACTTTATTGGTAGCAcTATATTATG	−8.60
denB.1	164573..164601	Minus	CAAATAAATAAGGGCTTCGGCCCTTTTGTTTTAA	−10.60
five.four	78461..78499	Minus	GTCACTCCGCCATGTGTTTCATATGGCTTTTTAA	−10.xx
Stp	162165..162200	Plus	TTCCTCACTGGCGTCCGAAGACGCCTTTAATTTT	−x.thirty
rIIB	164798..164834	Plus	TCCTTAGTTAAGGGCCGAAGCCCTTATTTAAATT	−ten.00

The asterisk ways that absence of terminator prediction by using Arnold or phiSITE programs.

A total of v,071 filtered variants (4,975 SNPs, 86 insertions and ten deletions) were identified (1 variant every 33 bases) between UFV13 and T4. 83,656 furnishings were assigned and categorized (395 high (0.472%), i,670 low (one.996%), two,722 moderate (3.25%) and 78,869 modifier (94.28%). The number of effects past functional class is: missense ii,879 (60.79%), nonsense 187 (3.95%) and silent 1,670 (35.26%). Because only genes with high or moderate variants, the mainly affected poly peptide category was that related to virion structural proteins, with gp7 beingness the most affected (Fig.2). This protein is considered the 2nd largest protein in the baseplate and is 1 of the vii components associated with wedge associates and stability ⁶² . The large number of SNPs found in virion proteins reflects the diversification of phage UFV13 from the classical T4 and can exist associated with the high capability to infect unlike bacterial genus such every bit Escherichia, Morganella and Shigella, an uncommon phage characteristic (information not shown).

Variants calling betwixt vB_EcoM-UFV13 and Enterobacteria phage T4 were predicted using SnpEff. Only variants with predicted "loftier" or "moderate" touch on on the protein-coding gene were analyzed and functionally categorized.

In guild to evaluate the phylogenetic human relationship betwixt UFV13 and genera belonging to the subfamily Tevenvirinae (T4virus, Cc31virus, S16virus, Js98virus and Sp18virus), a whole-genome tree was constructed. The phylogenetic tree divided phages into four clusters with vB_EcoM-UFV13 possessing the closest relationship with Shigella Shfl2 and Yersinia phage PST (Fig.iii), a result also supported by the SNP-based phylogenetic tree (Supplementary Figure²).

Phylogenetic relationship between phage UFV13 and genera belonging to the subfamily Tevenvirinae (T4virus, Cc31virus, S16virus, Js98virus and Sp18virus). vB_EcoM-UFV13 is most closely related to Shigella phage Shfl2 and Yersinia phage PST, and is conspicuously a member of the T4virus genus.

With the aim to establish the host range of phage UFV13 host range, in silico Host Phinder test was conducted. Four bacterial genera were predicted to be infected by UFV13: Escherichia (E-value: five.9e⁻¹), Yersinia (E-value: 5.8e^−ane), Shigella (E-value: 6.3e⁻¹) and Salmonella (Eastward-value: one.1e⁻ⁱⁱ).

Viral protein analysis

SDS PAGE analysis revealed the presence of eight proteins (Supplementary Figure³). Among these, four proteins were chosen and analyzed by MALDI/TOF-TOF, with the following being identified: UFV13_gp243 long tail fiber proximal subunit (139.95 kDa), E. coli chaperonin GroL (57.36 kDa), Escherichia phage vB_EcoM_112 major capsid protein (56.09 KDa) and E. coli outer membrane protein C (36.77 kDa). These proteins are deposited at UNIPROT under accession numbers A0A160CBJ3, A0A017I9Q1, A0A160CBB0 and A0A148HSV3, correspondingly. The presence of a common viral receptor (OmpC) and the chaperonin GroL highlights the need for viral purification enhancement. Viral isoelectric points are usually beneath six and some of them are able to demark to anion and cation substitution matrixes. However, host prison cell Deoxyribonucleic acid is efficiently removed by cation exchanger columns, while host cell proteins are effectively eliminated past anion commutation ⁶³ .

Physiological features

Viral power to survive in a wide range of adverse weather is a desired characteristic for therapeutic likewise as a biological command agents ⁶⁴ . Thus, phage stability was evaluated in unlike physical and chemical weather.

UFV13 was relatively stable within a pH range of seven.0–12.0. An approximate i log-fold reduction on viral titer was observed after incubation at pH iv.0 (18% of survivability) (Fig.4A). Interestingly, phage UFV13 was inactivated afterward ane h of incubation at pH ii.0, but not at pH 12 (68% viral viability), which is indicative of considerable virion stability at bones pH values.

The stability of vB_EcoM-UFV13 under unlike weather was evaluated. (A) Reductions of 100, 82, 4 and 32% of viable particles were observed after incubations, respectively, at pHs two, four, 10 and 12. (B) vB_EcoM-UFV13 was able to replicate at xxx and 22 °C with an efficiency of plating of 69 and 56%, corresponding; (C) vB_EcoM-UFV13 was inactivated at 95 °C for v min; (D) Osmotic shock irresolute reduced in 84% viral viability.

UFV13 was able to lyse Eastward. coli at xxx °C and 22 °C with a plating efficiency of 69 and 56%, respectively (Fig.4B). No lysis plates were observed later storage at 4 °C, which may be indicative of Deoxyribonucleic acid injection without host lysis.

Viral thermal inactivation occurred in the farthermost tested temperatures 95 and −xx °C (0 and 24% survival, respectively), while viral titer dropped to 50% when UFV13 was incubated for 40 min at 62 °C (Fig.4C). No significant reduction of phage titer was observed later on thermal handling at twoscore °C.

It was plant that osmotic pressure change, detergent and organic solvents determined a significant titer drop of UFV13. A survivability of 12% was observed when UFV13 underwent a rapid dilution from loftier-concentration NaCl buffer to depression-concentration ones (Fig.4D). The anionic detergent Sarkosyl reduced the number of feasible viral particles by 74%, while CTAB and SDS resulted in a complete inactivation of this virus (Fig.5). Anti-phage activity was also evidenced later on exposure to ethanol, chloroform, acetone and DMSO.

Viral stability under anionic and cationic detergents showed that vB_EcoM-UFV13 was sensible in all conditions.

Physiological features evaluated in this study are in accordance with Jurczak-Kurek et al. (2016). In a broad physiological study using 83 bacteriophages isolated from urban sewage, the same source of UFV13, it was verified that the vast majority of phages were sensitive to a temperature of 62 °C (survival below 70%), were able to survive in basic pH (ranging from 10 to 12), were susceptible to detergents and organic solvents, except chloroform, and were also resistant to osmotic daze.

Viral stability assays have besides been shown that UFV13 can survive in raw milk and it has potential adequacy to survive in mastitic milk. In general, mastitis can dampen the quality of raw milk limerick, which includes increased levels of Na⁺/Cl⁻ and pH ⁶⁵ . Evaluating a bacteriophage cocktail composed of two T4 phages in raw milk against E. coli, Porter et al. (2016) observed a three.3- to 5.half dozen-log reduction of bacterial growth over a 12-h physiologic temperature. Equally discussed below (particular 3.four), this study showed UFV13 activeness confronting Due east. coli in lactating female mice.

E. coli-induced mastitis mouse model

East. coli 30, an isolate obtained from a dairy cow with acute mastitis, displays resistance to xiv of 25 evaluated antibiotics (Supplementary Table⁵). This bacterium is resistant to at least three different antimicrobial drug classes, which allows its classification as a multi-drug resistant strain ⁶⁶ Moreover, of the four types of virulence factors analyzed (biofilm forming capability and motility types: swarming, swimming and twitching) the E. coli 30 was positive for biofilm formation, swarming, and swimming, being negative only for the twitching (Supplementary Tabular array⁶). Studies correlated this virulence factors to an increment in pathogenicity and immune response evasion ^67,68 .

Nowadays, several studies accept been used mouse mastitis models with the aim to evaluate potential anti-mastitis agents for employ in dairy cows ^{xx–25,69–71} although the authors are enlightened that cow factors are relevant in the mastitis establishment ²⁸ .

In order to evaluate UFV13′s in vivo activity against an MPEC strain and immune response to this treatment, an E. coli-induced mastitis model was employed. A 10-fold reduction of bacterial load was observed afterward viral inoculation using MOI ten (Supplementary Figure⁵).

Seven different cytokines (IL-6, TNF-α, IL-2, IFN-γ, IL-4, IL-10 and IL-17A) were measured, all the same only IL-x, TNF-α and IL-6 were identified as statistically significant (p < 0.05) (Fig.6).

Five unlike cytokines (IL-6, TNF-α, IL-2, IFN-γ and IL-x) were locally measured. But IL-10, TNF-α and IL-6 were statistically significant (*p < 0.05; **p < 0.01) and is indicative of a pro-inflammatory pattern after phage treatment. IL-17A and IL-four levels were not detected past the Cytometric Bead Array kit.

Studying whether T4 bacteriophage and T4-generated E. coli lysate influence cultures of peripheral blood mononuclear cells (PBMCs) activated or not past lipopolysaccharide (LPS), Bocian et al. (2016) observed that both preparations considerably increased the percentage of CD14+CD16−CD40+ and CD14+CD16−CD80 + monocytes in LPS-unactivated PBMCs cultures, too as the concentration of IL-vi and IL-12. Notwithstanding, this upshot suggests that T4 bacteriophages may act both as a pro-inflammatory inducer, and as well as CD40 activator, for this reason the increased expression of IL-6, IL-10, and TNF-α as a consequence of the presence of contaminating LPS left after the purification step rather than a property of the virion.

In an In vivo assessment of cytokine patterns followed past a unmarried-dose T4 bacteriophage application in an E. coli induced mastitis mouse model, our piece of work indicates that IL-x levels decreased locally in phage therapeutic group when compared to the negative control (PBS buffer) (Fig.6A). IL-ten has been extensively studied due its immunosuppressive features associated with the downregulation of pro-inflammatory cytokines, such equally TNF-α and IFN-γ, and the resolution of the inflammatory process ^72,73 . Evaluation of cytokine expression in the mammary gland in a mouse model of Streptococcus agalactiae mastitis performed by Trigo et al. (2009) revealed that the maximum concentration of IL-ten occurred after 72 hours and was correlated with a decreased level of TNF-α. This finding is in accordance with our results. Reduced IL-10 levels (Fig.6A) and increased TNF- α (Fig.6B) and IL-6 (Fig.6D) is indicative of an ongoing inflammatory process. In fact, when only Eastward. coli 30 was inoculated, an increased affluence of TNF-α was also observed when compared with the negative control. Although phage and E. coli xxx were individually able to induce an inflammatory response, phage treatment (ten³ PFU) did not provoke an condiment outcome on the production of any pro-inflammatory cytokine. Indeed, the IL-6 level macerated (Fig.6D) after phage handling. Unlike to what was found past Trigo et al. (2009), IFN-γ levels were detected in all groups, however no statistical difference was observed between the groups, which was likewise applicable to IL-ii (Fig.6C–E, respectively).

The absence of detectable IL-four and IL-17A cytokines, respectively present in Th2 and Th17 inflammatory responses, indicates that the use of T4 phage in mammary glands infected with E. coli induces Th1 T-cell responses. Th1 pattern is involved in a cellular allowed response that protects confronting intracellular infections by viruses and microorganisms that grow in macrophages ⁷⁴ .

Histological analysis of the mammary gland in the control group (Fig.7A) shows intact tissue morphology described by well delimited cells and acini, too equally the presence of fat cells and a milky secretion, even when E. coli 30 (~100 cells) were inoculated (Fig.7B). Inoculation of the phage UFV13 (MOI 10) in the treated group led to an inflammatory reaction characterized by tissue damage, neutrophil infiltrates and mischaracterization of the acini border, although low levels of pro-inflammatory cytokines have been constitute as discussed previously (Fig.7C).

Histological assay of mammary gland later on PBS (A), E. coli thirty (B) and handling with vB_EcoM-UFV13 (C). In C, neutrophil infiltration (indicated by pointer caput) was detected 48 hours later on phage treatment using MOI 10. Bars: 100 micrometers.

Conclusion

Viral genomic assay is a crucial step in bacteriophage screening for their utilize as an antibacterial agent. The UFV13 virus has no lysogenic modules or genes conferring antibody resistance. Viral stability analysis in the presence of detergents and organic solvents and incubation at unlike pHs and temperatures, have shown that the UFV13 virus presents high survivability at basic pHs and is relatively resistant under incubation at 62 °C for xl min. vB_EcoM-UFV13 used in an beast model for mastitis reduced the full bacterial load past 90%, as well as inducing pro-inflammatory cytokines such as IL-6 and TNF-α, which makes information technology a potential biological agent capable of controlling acute infections caused past E. coli dairy cows.

Electronic supplementary material

Acknowledgements

We are grateful to the Núcleo de Análise de Biomoléculas and Núcleo de Microscopia due east Microanálise of the Universidade Federal de Viçosa for providing the facilities to conduct the experiments. Nosotros also acknowledge the financial support of the following Brazilian agencies: Fundação de Amparo à Pesquisa practise Estado de Minas Gerais (Fapemig), Coordenacão de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Financiadora de Estudos e Projetos (Finep), Sistema Nacional de Laboratórios em Nanotecnologias (SisNANO)/Ministério da ciência, tecnologia east Informação (MCTI). Nosotros are as well grateful to Empresa Brasileira de Pesquisa Agropecuária (EMBRAPA), Gado de Leite Farm, Juiz de Fora, Minas Gerais, Brazil, that kindly provided u.s.a. with Escherichia coli 30.

Author Contributions

V.S.D., R.S.D. and Southward.O.P. conceived and designed the experiments; Five.Due south.D., A.M.Chiliad., Due south.C., L.T., A.Ten., C.G.F. and P.M.P.V. performed genomic analysis; C.S. contributed to Eastward. coli-induced mastitis mouse model; M.Due south.V., I.S.P., and Thou.R.Southward. conducted phage physiological features assays. F.M. took part in the histological analysis; J.S.C. was involved in protein profile experiments; C.C.Southward. contributed materials. 5.Due south.D. wrote the main manuscript text. All the authors have read and contributed to the last version of the manuscript.

Notes

Competing Interests

The authors declare no competing interests.

Footnotes

Electronic supplementary material

Supplementary information accompanies this newspaper at ten.1038/s41598-018-24896-west.

Publisher's notation: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

References

1. Shaheen Yard, Tantary H, Nabi South. A Treatise on Bovine Mastitis: Affliction and Illness Economics, Etiological Ground, Run a risk Factors, Impact on Human Health, Therapeutic Management, Prevention and Control Strategy. Adv. Dairy Res. 2016;4:1–ten. [Google Scholar]

two. Thomas V, et al. Antimicrobial susceptibility monitoring of mastitis pathogens isolated from acute cases of clinical mastitis in dairy cows across Europe: VetPath results. Int. J. Antimicrob. Agents. 2015;46:thirteen–twenty. doi: 10.1016/j.ijantimicag.2015.03.013. [PubMed] [CrossRef] [Google Scholar]

3. Zeinhom MMA, Abdel-Latef GK. Public health risk of some milk borne pathogens. Beni-Suef Univ. J. Basic Appl. Sci. 2014;3:209–215. [Google Scholar]

4. Crispie F, Flynn J, Ross RP, Loma C, Meaney WJ. Dry moo-cow therapy with a non-antibiotic intramammary teat seal - a review. Ir. Vet. J. 2004;57:412. doi: 10.1186/2046-0481-57-7-412. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

5. Down PM, Dark-green MJ, Hudson CD. Rate of manual: A major determinant of the cost of clinical mastitis. J. Dairy Sci. 2013;96:6301–6314. doi: x.3168/jds.2012-6470. [PubMed] [CrossRef] [Google Scholar]

vi. Blum, S. E., Heller, E. D., Jacoby, Due south., Krifucks, O. & Leitner, Thousand. Comparing of the allowed responses associated with experimental bovine mastitis acquired by different strains of Escherichia coli, 190–197, 10.1017/S0022029917000206 (2017). [PubMed]

7. Schmelcher K, Powell AM, Camp MJ, Pohl CS, Donovan DM. Synergistic streptococcal phage λSA2 and B30 endolysins kill streptococci in cow milk and in a mouse model of mastitis. Appl. Microbiol. Biotechnol. 2015;99:8475–8486. doi: 10.1007/s00253-015-6579-0. [PMC costless commodity] [PubMed] [CrossRef] [Google Scholar]

8. Bryan, D., El-Shibiny, A., Hobbs, Z., Porter, J. & Kutter, E. Chiliad. Bacteriophage T4 infection of stationary phase E. coli: Life afterwards log from a phage perspective. Front. Microbiol. 7 (2016). [PMC free article] [PubMed]

nine. Porter J, Anderson J, Carter L, Donjacour Due east, Paros 1000. In vitro evaluation of a novel bacteriophage cocktail as a preventative for bovine coliform mastitis. J. Dairy Sci. 2016;99:2053–2062. doi: 10.3168/jds.2015-9748. [PubMed] [CrossRef] [Google Scholar]

10. Dias RS, et al. Utilize of phages against antibiotic-resistant Staphylococcus aureus isolated from bovine mastitis 1. J. Anim. Sci. 2013;91:3930–3939. doi: 10.2527/jas.2012-5884. [PubMed] [CrossRef] [Google Scholar]

11. Sulakvelidze A. The challenges of bacteriophage therapy. Ind. Pharm. 2011;45:xiv–xviii. [Google Scholar]

12. Gill JJ, et al. Efficacy and Pharmacokinetics of Bacteriophage Therapy in Treatment of Subclinical Staphylococcus aureus Mastitis in Lactating Dairy Cattle. Antimicrob. Agents Chemother. 2006;l:2912–2918. doi: 10.1128/AAC.01630-05. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

13. Merril CR, Scholl D, Adhya SL. The prospect for bacteriophage therapy in Western medicine. Nat. Rev. Drug Discov. 2003;two:489–97. doi: 10.1038/nrd1111. [PubMed] [CrossRef] [Google Scholar]

14. Miller ES, et al. Bacteriophage T4 Genome Bacteriophage T4 Genome † Microbiol. Mol. Biol. Rev. 2003;67:86–156. doi: ten.1128/MMBR.67.1.86-156.2003. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

15. Chibani-Chennoufi S, Dillmann ML, Marvin-Guy L, Rami-Shojaei Due south, Brüssow H. Lactobacillus plantarum bacteriophage LP65: A new fellow member of the SPO1-like genus of the family myoviridae. J. Bacteriol. 2004;186:7069–7083. doi: x.1128/JB.186.21.7069-7083.2004. [PMC costless article] [PubMed] [CrossRef] [Google Scholar]

sixteen. Abouhmad A, Mamo Thousand, Dishisha T, Amin MA, Hatti-Kaul R. T4 lysozyme fused with cellulosebinding module for antimicrobial cellulosic wound dressing materials. J. Appl. Microbiol. 2016;121:115–125. doi: 10.1111/jam.13146. [PubMed] [CrossRef] [Google Scholar]

17. Rodríguez-Rubio L, Martínez B, Donovan DM, Rodríguez A, García P. Bacteriophage virionassociated peptidoglycan hydrolases: potential new enzybiotics. Crit. Rev. Microbiol. 2013;39:427–434. doi: 10.3109/1040841X.2012.723675. [PubMed] [CrossRef] [Google Scholar]

xviii. Bruttin A, Brüssow H, Bru H. Human Volunteers Receiving Escherichia coli Phage T4 Orally : a Rubber Exam of Phage Therapy These include : Human Volunteers Receiving Escherichia coli Phage T4 Orally : a Safety Exam of Phage Therapy. Antimicrob. Agents Chemother. 2005;49:2874–2878. doi: 10.1128/AAC.49.seven.2874-2878.2005. [PMC free commodity] [PubMed] [CrossRef] [Google Scholar]

19. Bocian, K. et al. LPS-activated monocytes are unresponsive to T4 phage and T4-generated Escherichia coli lysate. Front end. Microbiol. vii (2016). [PMC gratis article] [PubMed]

xx. Olson, One thousand. A., Siebach, T. W., Griffitts, J. S., Wilson, E. & Erickson, D. L. Genome-broad identification of fitness factors in mastitisassociated Escherichia coli. Appl. Environ. Microbiol. 84 (2018). [PMC free commodity] [PubMed]

21. Wang J, et al. Oligopeptide Targeting Sortase A as Potential Anti-infective Therapy for Staphylococcus aureus. Front. Microbiol. 2018;ix:1–10. doi: 10.3389/fmicb.2018.00001. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

22. Iwano H, et al. Biology (Basel) 2018. Bacteriophage Φ SA012 Has a Broad Host Range against Staphylococcus aureus and Constructive Lytic Capacity in a Mouse Mastitis Model; p. 8. [PMC complimentary article] [PubMed] [Google Scholar]

23. Hu M, et al. Cynatratoside-C from Cynanchum atratum displays anti-inflammatory effect via suppressing TLR4 mediated NF-κB and MAPK signaling pathways in LPS-induced mastitis in mice. Chem. Biol. Interact. 2018;279:187–195. doi: x.1016/j.cbi.2017.x.017. [PubMed] [CrossRef] [Google Scholar]

24. Roussel P, et al. Escherichia coli mastitis strains: In vitro phenotypes and severity of infection in vivo. Plos I. 2017;12:1–20. doi: x.1371/journal.pone.0178285. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

25. Johnzon CF, et al. Mastitis pathogens with high virulence in a mouse model produce a distinct cytokine profile in vivo. Front. Immunol. 2016;7:one–11. [PMC free article] [PubMed] [Google Scholar]

26. Yu Y, et al. Efficacy of cefquinome against Escherichia coli environmental mastitis assessed by pharmacokinetic and pharmacodynamic integration in lactating mouse model. Front. Microbiol. 2017;8:1–9. [PMC gratuitous article] [PubMed] [Google Scholar]

27. Ingman WV, Glynn DJ, Hutchinson MR. Mouse models of mastitis – how physiological are they? Int. Breastfeed. J. 2015;10:12. doi: 10.1186/s13006-015-0038-5. [PMC costless article] [PubMed] [CrossRef] [Google Scholar]

28. Burvenich C, Van Merris Five, Mehrzad J, Diez-Fraile A, Duchateau 50. Severity of E. coli mastitis is mainly determined past cow factors. Veterinary Enquiry. 2003;34:521–564. doi: 10.1051/vetres:2003023. [PubMed] [CrossRef] [Google Scholar]

29. Sambrook, J. & Russell, D. W. Molecular Cloning - Sambrook & Russel - Vol. 1, 2, three. Cold Springs Harb. Lab. Press 3th Editio (2001).

xxx. Adams, M. Bacteriophages. Bacteriophages 620 (1959).

31. Duarte, 5. S. et al. Complete genome sequence of vB_EcoM-UFV13, a new bacteriophage able to disrupt Trueperella pyogenes biofilm. Genome Announc. four (2016). [PMC complimentary article] [PubMed]

32. Gasteiger E, et al. ExPASy: The proteomics server for in-depth protein cognition and assay. Nucleic Acids Res. 2003;31:3784–3788. doi: 10.1093/nar/gkg563. [PMC gratuitous article] [PubMed] [CrossRef] [Google Scholar]

33. Lowe TM, Boil SR. TRNAscan-SE: A program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1996;25:955–964. doi: 10.1093/nar/25.5.0955. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

34. Naville Yard, Ghuillot-Gaudeffroy A, Marchais A, Gautheret D. RNA Biology. 2011. ARNold: a web tool for the prediction of Rho-independent transcription terminators; pp. eleven–13. [PubMed] [Google Scholar]

35. Klucar L, Stano M, Hajduk K. phiSITE: database of gene regulation in bacteriophages. Nucleic Acids Res. 2010;38:D366–D370. doi: 10.1093/nar/gkp911. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

36. Grant, J. R. & Stothard, P. The CGView Server: a comparative genomics tool for circular genomes. Nucleic Acids Res. 36 (2008). [PMC free article] [PubMed]

37. Bolger AM, Lohse M, Usadel B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–2120. doi: 10.1093/bioinformatics/btu170. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

38. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat. Methods. 2012;nine:357–359. doi: 10.1038/nmeth.1923. [PMC gratis article] [PubMed] [CrossRef] [Google Scholar]

39. Li H, et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009;25:2078–2079. doi: ten.1093/bioinformatics/btp352. [PMC complimentary article] [PubMed] [CrossRef] [Google Scholar]

40. Cingolani P, et al. A program for annotating and predicting the effects of single nucleotide polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly (Austin). 2012;six:eighty–92. doi: 10.4161/fly.19695. [PMC gratis commodity] [PubMed] [CrossRef] [Google Scholar]

41. Darling ACE, Mau B, Blattner FR, Perna NT. Mauve: Multiple alignment of conserved genomic sequence with rearrangements. Genome Res. 2004;14:1394–1403. doi: 10.1101/gr.2289704. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

42. Treu L, et al. The impact of genomic variability on cistron expression in environmental Saccharomyces cerevisiae strains. Environ. Microbiol. 2014;16:1378–1397. doi: 10.1111/1462-2920.12327. [PubMed] [CrossRef] [Google Scholar]

43. Tuimala, J. A primer to phylogenetic assay using the PHYLIP parcel. Espoo Republic of finland Heart for Scientific Computing Ltd 6 (2006).

44. Huson DH, et al. Dendroscope: An interactive viewer for large phylogenetic trees. BMC Bioinformatics. 2007;8:460. doi: 10.1186/1471-2105-8-460. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

45. Larkin MA, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23:2947–2948. doi: x.1093/bioinformatics/btm404. [PubMed] [CrossRef] [Google Scholar]

46. Katoh K, Standley DM. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 2013;30:772–780. doi: 10.1093/molbev/mst010. [PMC complimentary article] [PubMed] [CrossRef] [Google Scholar]

47. Kumar, S., Stecher, G. & Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol. Biol. Evol. msw054, 10.1093/molbev/msw054 (2016). [PMC costless article] [PubMed]

48. Villarroel, J. et al. HostPhinder: A phage host prediction tool. Viruses 8 (2016). [PMC costless article] [PubMed]

50. Shevchenko A, Tomas H, Havli\[sbreve] J, Olsen JV, Mann Grand. In-gel digestion for mass spectrometric label of proteins and proteomes. Nat. Protoc. 2007;1:2856–2860. doi: 10.1038/nprot.2006.468. [PubMed] [CrossRef] [Google Scholar]

51. Jurczak-Kurek A, et al. Biodiversity of bacteriophages: morphological and biological properties of a large group of phages isolated from urban sewage. Sci. Rep. 2016;half dozen:34338. doi: ten.1038/srep34338. [PMC free commodity] [PubMed] [CrossRef] [Google Scholar]

52. Déziel E, Comeau Y, Villemur R. Initiation of biofilm formation past Pseudomonas aeruginosa 57RP correlates with emergence of hyperpiliated and highly adherent phenotypic variants deficient in swimming, swarming, and twitching motilities. J. Bacteriol. 2001;183:1195–1204. doi: 10.1128/JB.183.4.1195-1204.2001. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

53. Belgini DRB, et al. Culturable bacterial multifariousness from a feed water of a opposite osmosis organization, evaluation of biofilm formation and biocontrol using phages. World J. Microbiol. Biotechnol. 2014;30:2689–2700. doi: ten.1007/s11274-014-1693-1. [PubMed] [CrossRef] [Google Scholar]

54. CLSI. Operation Standards for Antimicrobial Susceptibility Testing; Twenty-Seventh Edition. Clinical and Laboratory Standards Establish (2017).

55. Chandler RL. Studies on experimental mouse mastitis relative to the assessment of pharmaceutical substances. J. Comp. Pathol. 1971;81:507–514. doi: 10.1016/0021-9975(71)90078-8. [PubMed] [CrossRef] [Google Scholar]

56. Naghili H, et al. Validation of drib plate technique for bacterial enumeration past parametric and nonparametric tests. Vet. Res. forum an Int. Q. J. 2013;iv:179–83. [PMC free article] [PubMed] [Google Scholar]

57. Ackermann HW. Bacteriophage observations and development. Research in Microbiology. 2003;154:245–251. doi: 10.1016/S0923-2508(03)00067-6. [PubMed] [CrossRef] [Google Scholar]

58. Belle A, Landthaler M, Shub DA. Intronless homing: Site-specific endonuclease SegF of bacteriophage T4 mediates localized marker exclusion coordinating to homing endonucleases of grouping I introns. Genes Dev. 2002;16:351–362. doi: ten.1101/gad.960302. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

59. Comeau AM, Arbiol C, Krisch HM. Composite conserved promoter-terminator motifs (PeSLs) that mediate modular shuffling in the diverse T4-similar myoviruses. Genome Biol. Evol. 2014;six:1611–1619. doi: 10.1093/gbe/evu129. [PMC gratuitous article] [PubMed] [CrossRef] [Google Scholar]

lx. Jun JW, et al. Bacteriophage application to command the contaminated water with Shigella. Sci. Rep. 2016;6:22636. doi: 10.1038/srep22636. [PMC free article] [PubMed] [CrossRef] [Google Scholar]

61. Hinton DM. Transcriptional control in the prereplicative phase of T4 development. Virol. J. 2010;7:289. doi: 10.1186/1743-422X-7-289. [PMC free commodity] [PubMed] [CrossRef] [Google Scholar]

63. Kramberger P, Urbas L, Štrancar A. Downstream processing and chromatography based analytical methods for product of vaccines, gene therapy vectors, and bacteriophages. Human being Vaccines and Immunotherapeutics. 2015;xi:1010–1021. doi: ten.1080/21645515.2015.1009817. [PMC gratuitous article] [PubMed] [CrossRef] [Google Scholar]

64. Thung TY, et al. Utilize of a lytic bacteriophage to control Salmonella Enteritidis in retail nutrient. LWT - Food Sci. Technol. 2017;78:222–225. doi: 10.1016/j.lwt.2016.12.044. [CrossRef] [Google Scholar]

65. Ogola H, Shitandi A, Nanua J. Event of mastitis on raw milk compositional quality. J. Vet. Sci. 2007;8:237–242. doi: ten.4142/jvs.2007.viii.3.237. [PMC complimentary article] [PubMed] [CrossRef] [Google Scholar]

66. Zhanel GG, Zhanel MA, Karlowsky JA. Oral Fosfomycin for the Treatment of Acute and Chronic Bacterial Prostatitis Acquired by Multidrug-Resistant Escherichia coli. Tin. J. Infect. Dis. Med. Microbiol. 2018;2018:1–ix. [PMC free article] [PubMed] [Google Scholar]

67. Domenech M, Ramos-Sevillano Due east, García East, Moscoso G, Yuste J. Biofilm formation avoids complement immunity and phagocytosis of Streptococcus pneumoniae. Infect. Immun. 2013;81:2606–2615. doi: 10.1128/IAI.00491-13. [PMC complimentary article] [PubMed] [CrossRef] [Google Scholar]

68. Kao CY, et al. The complex interplay among bacterial motility and virulence factors in different Escherichia coli infections. Eur. J. Clin. Microbiol. Infect. Dis. 2014;33:2157–2162. doi: 10.1007/s10096-014-2171-2. [PubMed] [CrossRef] [Google Scholar]

69. Brouillette East, Grondin G, Talbot BG, Malouin F. Inflammatory cell infiltration equally an indicator of Staphylococcus aureus infection and therapeutic efficacy in experimental mouse mastitis. Vet. Immunol. Immunopathol. 2005;104:163–169. doi: 10.1016/j.vetimm.2004.eleven.006. [PubMed] [CrossRef] [Google Scholar]

70. Brouillette Eastward, Malouin F. The pathogenesis and control of Staphylococcus aureus-induced mastitis: Study models in the mouse. Microbes Infect. 2005;7:560–568. doi: 10.1016/j.micinf.2004.11.008. [PubMed] [CrossRef] [Google Scholar]

71. Nazemi Due south, et al. Expression of acute phase proteins and inflammatory cytokines in mouse mammary gland following Staphylococcus aureus challenge and in response to milk accumulation. J. Dairy Res. 2014;81:445–54. doi: 10.1017/S0022029914000454. [PubMed] [CrossRef] [Google Scholar]

72. Trigo G, et al. Leukocyte populations and cytokine expression in the mammary gland in a mouse model of Streptococcus agalactiae mastitis. J. Med. Microbiol. 2009;58:951–958. doi: ten.1099/jmm.0.007385-0. [PubMed] [CrossRef] [Google Scholar]

73. Masso-Welch PA, Merhige PM, Veeranki OLM, Kuo Southward-K. Loss of IL-10 Decreases Mouse Postpubertal Mammary Gland Development in the Absence of Inflammation. Immunol. Invest. 2012;41:521–537. doi: 10.3109/08820139.2012.684193. [PubMed] [CrossRef] [Google Scholar]

74. Kaiko GE, Horvat JC, Beagley KW, Hansbro PM. Immunological decision-making: How does the immune organisation decide to mount a helper T-cell response? Immunology. 2008;123:326–338. doi: ten.1111/j.1365-2567.2007.02719.x. [PMC gratuitous article] [PubMed] [CrossRef] [Google Scholar]

---

Articles from Scientific Reports are provided here courtesy of Nature Publishing Group

---

brookshirehobbiregrato.blogspot.com

Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5931544/